purelink hipure plasmid midiprep kit (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
purelink hipure plasmid midiprep kit
Purelink Hipure Plasmid Midiprep Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hipure+plasmid+midiprep+kit/purelink+rna+mini+kit/pm40430080-200-5-10
Average 90 stars, based on 1 article reviews
Purelink Hipure Plasmid Midiprep Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/hipure+plasmid+midiprep+kit/purelink+rna+mini+kit/pm40430080-200-5-10
Average 90 stars, based on 1 article reviews
purelink hipure plasmid midiprep kit - by Bioz Stars,
2026-10
90/100 stars
Images
Related Articles
Purification:Article Title: White adipocytes in subcutaneous fat depots require KLF15 for maintenance in preclinical models Article Snippet: Klf15 (NM_023184) mouse tagged (Myc-DDK) ORF was cloned into a pCMV6-Entry vector (MR206548, ORIGENE). .. All plasmids were purified using the Article Title: A CRM1-dependent nuclear export signal in Autographa californica multiple nucleopolyhedrovirus Ac93 is important for the formation of intranuclear microvesicles. Article Snippet: Autographa californica multiple nucleopolyhedrovirus (AcMNPV) Ac93 is highly conserved in all sequenced baculovirus genomes, and it plays important roles in both the nuclear egress of nucleocapsids and the formation of intranuclear microve sicles.. In this study, we characterized a cellular CRM1-dependent nuclear export signal (NES) of AcMNPV Ac93.. Bioinformatic analysis revealed that AcMNPV Ac93 may contain an NES at amino acids 115–125. Plasmid Preparation:Article Title: White adipocytes in subcutaneous fat depots require KLF15 for maintenance in preclinical models Article Snippet: Klf15 (NM_023184) mouse tagged (Myc-DDK) ORF was cloned into a pCMV6-Entry vector (MR206548, ORIGENE). .. All plasmids were purified using the Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: Seventy nanograms of the pEYA2::PKS or pEYA2::vdtA entry vector and 100 ng of the pTYGSarg or pTYGSade destination vector38 were mixed with 1 μL of the Gateway LR Clonase II enzyme (Thermo Fisher Scientific) in a 5 μL final volume, and the reaction mixture was incubated at 25 °C for 2 h. The total reaction mixture was introduced into chemically competent E. coli DH5a cells (Thermo Fisher Scientific) using a heat shock protocol. .. The pTYGSarg::PKS and pTYGSade::vdtA expression vectors were isolated from positive colonies using the Zyppy plasmid miniprep kit (Zymo Research) and the Article Title: A CRM1-dependent nuclear export signal in Autographa californica multiple nucleopolyhedrovirus Ac93 is important for the formation of intranuclear microvesicles. Article Snippet: Autographa californica multiple nucleopolyhedrovirus (AcMNPV) Ac93 is highly conserved in all sequenced baculovirus genomes, and it plays important roles in both the nuclear egress of nucleocapsids and the formation of intranuclear microve sicles.. In this study, we characterized a cellular CRM1-dependent nuclear export signal (NES) of AcMNPV Ac93.. Bioinformatic analysis revealed that AcMNPV Ac93 may contain an NES at amino acids 115–125. Article Title: Miktoarm Star-polypept(o)ide-Based Polyion Complex Micelles for the Delivery of Large Nucleic Acids. Article Snippet: .. Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12), RPMI-1640, EDTA, trypan blue, UltraPure agarose, Subcloning Efficiency DH5a competent cells, Article Title: Sertad1 is elevated and plays a necessary role in synaptic loss, neuron death and cognitive impairment in a model of Alzheimer’s disease Article Snippet: .. DNA preparation was done using the Article Title: Miktoarm Star-polypept(o)ide-Based Polyion Complex Micelles for the Delivery of Large Nucleic Acids Article Snippet: .. Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12), RPMI-1640, EDTA, trypan blue, UltraPure agarose, Subcloning Efficiency DH5a competent cells, Article Title: 2.7 Å cryo-EM structure of human telomerase H/ACA ribonucleoprotein Article Snippet: The sequences of the primers used are listed below: pcDNA 3.1 3xFLAG-dyskerin_I30M (Forward: TGTAGCCGAAATGCAACACGCTG, Reverse: TCTTCTTCTGGCAATGACTTCC) pcDNA 3.1 3xFLAG-dyskerin_Q31E (Forward: AGCCGAAATAGAACACGCTGAAG, Reverse: ACATCTTCTTCTGGCAATGAC) pcDNA 3.1 3xFLAG-dyskerin_Q31K (Forward: AGCCGAAATAAAACACGCTGAAG, Reverse: ACATCTTCTTCTGGCAATGAC) pcDNA 3.1 3xFLAG-dyskerin_F36V (Forward: CGCTGAAGAAGTGCTTATCAAAC, Reverse: TGTTGTATTTCGGCTAC) pcDNA 3.1 3xFLAG-dyskerin_K43E (Forward: ACCTGAATCCGAAGTTGCTAAGTTG, Reverse: TTGATAAGAAATTCTTCAGCGTG) pcDNA 3.1 3xFLAG-dyskerin_L56S (Forward: GCCCCTTTTGAGCAAGAATTTTGATAAG, Reverse: CACTGAGACGTGTCC) pcDNA 3.1 3xFLAG-dyskerin_H68A (Forward: AAGGACAACAGCGTATACACCTCTTGCATGTG, Reverse: ACATTCAGCTTATCAAAATTC) pcDNA 3.1 3xFLAG-dyskerin_T66A_T67A_H68A (Forward: CGGCGTATACACCTCTTGCATGTG, Reverse: CCGCCCTTACATTCAGCTTATCAAAATTC) pBS-U3-hTR-500_G450A (Forward: GCTCACACATACAGTTCCATGG, Reverse: CGAGTCCTGGGTGCA) pBS-U3-hTR-500_G450C (Forward: GCTCACACATCCAGTTCCATGG, Reverse: CGAGTCCTGGGTGCA) pBS-U3-hTR-500_G450U (Forward: GCTCACACATTCAGTTCCATGG, Reverse: CGAGTCCTGGGTGCA) Mutant pBS-U3-hTR-500 or pcDNA 3.1 3xFLAG-dyskerin (Addgene, Plasmid #126870) constructs were generated using NEB Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554) and confirmed by DNA sequencing. .. Plasmids were prepared using Invitrogen Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: The plasmid was isolated from confirmed positive clones using the Zyppy plasmid miniprep kit (Zymo Research), and the plasmid was validated by sequencing (Macrogen, Seoul, South Korea) with sequencing primers (Table S9). .. Plasmid pTYGSade::FAS1::FASs2 was subsequently isolated from a sequence confirmed clone by the Expressing:Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: Seventy nanograms of the pEYA2::PKS or pEYA2::vdtA entry vector and 100 ng of the pTYGSarg or pTYGSade destination vector38 were mixed with 1 μL of the Gateway LR Clonase II enzyme (Thermo Fisher Scientific) in a 5 μL final volume, and the reaction mixture was incubated at 25 °C for 2 h. The total reaction mixture was introduced into chemically competent E. coli DH5a cells (Thermo Fisher Scientific) using a heat shock protocol. .. The pTYGSarg::PKS and pTYGSade::vdtA expression vectors were isolated from positive colonies using the Zyppy plasmid miniprep kit (Zymo Research) and the Isolation:Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: Seventy nanograms of the pEYA2::PKS or pEYA2::vdtA entry vector and 100 ng of the pTYGSarg or pTYGSade destination vector38 were mixed with 1 μL of the Gateway LR Clonase II enzyme (Thermo Fisher Scientific) in a 5 μL final volume, and the reaction mixture was incubated at 25 °C for 2 h. The total reaction mixture was introduced into chemically competent E. coli DH5a cells (Thermo Fisher Scientific) using a heat shock protocol. .. The pTYGSarg::PKS and pTYGSade::vdtA expression vectors were isolated from positive colonies using the Zyppy plasmid miniprep kit (Zymo Research) and the Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: The plasmid was isolated from confirmed positive clones using the Zyppy plasmid miniprep kit (Zymo Research), and the plasmid was validated by sequencing (Macrogen, Seoul, South Korea) with sequencing primers (Table S9). .. Plasmid pTYGSade::FAS1::FASs2 was subsequently isolated from a sequence confirmed clone by the Transformation Assay:Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: Seventy nanograms of the pEYA2::PKS or pEYA2::vdtA entry vector and 100 ng of the pTYGSarg or pTYGSade destination vector38 were mixed with 1 μL of the Gateway LR Clonase II enzyme (Thermo Fisher Scientific) in a 5 μL final volume, and the reaction mixture was incubated at 25 °C for 2 h. The total reaction mixture was introduced into chemically competent E. coli DH5a cells (Thermo Fisher Scientific) using a heat shock protocol. .. The pTYGSarg::PKS and pTYGSade::vdtA expression vectors were isolated from positive colonies using the Zyppy plasmid miniprep kit (Zymo Research) and the Concentration Assay:Article Title: A CRM1-dependent nuclear export signal in Autographa californica multiple nucleopolyhedrovirus Ac93 is important for the formation of intranuclear microvesicles. Article Snippet: Autographa californica multiple nucleopolyhedrovirus (AcMNPV) Ac93 is highly conserved in all sequenced baculovirus genomes, and it plays important roles in both the nuclear egress of nucleocapsids and the formation of intranuclear microve sicles.. In this study, we characterized a cellular CRM1-dependent nuclear export signal (NES) of AcMNPV Ac93.. Bioinformatic analysis revealed that AcMNPV Ac93 may contain an NES at amino acids 115–125. Spectrophotometry:Article Title: A CRM1-dependent nuclear export signal in Autographa californica multiple nucleopolyhedrovirus Ac93 is important for the formation of intranuclear microvesicles. Article Snippet: Autographa californica multiple nucleopolyhedrovirus (AcMNPV) Ac93 is highly conserved in all sequenced baculovirus genomes, and it plays important roles in both the nuclear egress of nucleocapsids and the formation of intranuclear microve sicles.. In this study, we characterized a cellular CRM1-dependent nuclear export signal (NES) of AcMNPV Ac93.. Bioinformatic analysis revealed that AcMNPV Ac93 may contain an NES at amino acids 115–125. Modification:Article Title: Miktoarm Star-polypept(o)ide-Based Polyion Complex Micelles for the Delivery of Large Nucleic Acids. Article Snippet: .. Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12), RPMI-1640, EDTA, trypan blue, UltraPure agarose, Subcloning Efficiency DH5a competent cells, Article Title: Miktoarm Star-polypept(o)ide-Based Polyion Complex Micelles for the Delivery of Large Nucleic Acids Article Snippet: .. Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12), RPMI-1640, EDTA, trypan blue, UltraPure agarose, Subcloning Efficiency DH5a competent cells, Subcloning:Article Title: Miktoarm Star-polypept(o)ide-Based Polyion Complex Micelles for the Delivery of Large Nucleic Acids. Article Snippet: .. Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12), RPMI-1640, EDTA, trypan blue, UltraPure agarose, Subcloning Efficiency DH5a competent cells, Article Title: Miktoarm Star-polypept(o)ide-Based Polyion Complex Micelles for the Delivery of Large Nucleic Acids Article Snippet: .. Dulbecco’s Modified Eagle’s Medium/F12 (DMEM/F12), RPMI-1640, EDTA, trypan blue, UltraPure agarose, Subcloning Efficiency DH5a competent cells, Transfection:Article Title: 2.7 Å cryo-EM structure of human telomerase H/ACA ribonucleoprotein Article Snippet: The sequences of the primers used are listed below: pcDNA 3.1 3xFLAG-dyskerin_I30M (Forward: TGTAGCCGAAATGCAACACGCTG, Reverse: TCTTCTTCTGGCAATGACTTCC) pcDNA 3.1 3xFLAG-dyskerin_Q31E (Forward: AGCCGAAATAGAACACGCTGAAG, Reverse: ACATCTTCTTCTGGCAATGAC) pcDNA 3.1 3xFLAG-dyskerin_Q31K (Forward: AGCCGAAATAAAACACGCTGAAG, Reverse: ACATCTTCTTCTGGCAATGAC) pcDNA 3.1 3xFLAG-dyskerin_F36V (Forward: CGCTGAAGAAGTGCTTATCAAAC, Reverse: TGTTGTATTTCGGCTAC) pcDNA 3.1 3xFLAG-dyskerin_K43E (Forward: ACCTGAATCCGAAGTTGCTAAGTTG, Reverse: TTGATAAGAAATTCTTCAGCGTG) pcDNA 3.1 3xFLAG-dyskerin_L56S (Forward: GCCCCTTTTGAGCAAGAATTTTGATAAG, Reverse: CACTGAGACGTGTCC) pcDNA 3.1 3xFLAG-dyskerin_H68A (Forward: AAGGACAACAGCGTATACACCTCTTGCATGTG, Reverse: ACATTCAGCTTATCAAAATTC) pcDNA 3.1 3xFLAG-dyskerin_T66A_T67A_H68A (Forward: CGGCGTATACACCTCTTGCATGTG, Reverse: CCGCCCTTACATTCAGCTTATCAAAATTC) pBS-U3-hTR-500_G450A (Forward: GCTCACACATACAGTTCCATGG, Reverse: CGAGTCCTGGGTGCA) pBS-U3-hTR-500_G450C (Forward: GCTCACACATCCAGTTCCATGG, Reverse: CGAGTCCTGGGTGCA) pBS-U3-hTR-500_G450U (Forward: GCTCACACATTCAGTTCCATGG, Reverse: CGAGTCCTGGGTGCA) Mutant pBS-U3-hTR-500 or pcDNA 3.1 3xFLAG-dyskerin (Addgene, Plasmid #126870) constructs were generated using NEB Q5 Site-Directed Mutagenesis Kit (NEB, Cat# E0554) and confirmed by DNA sequencing. .. Plasmids were prepared using Invitrogen Sequencing:Article Title: Identification of a Biosynthetic Gene Cluster for the Production of the Blue-Green Pigment Xylindein by the Fungus Chlorociboria aeruginascens . Article Snippet: The plasmid was isolated from confirmed positive clones using the Zyppy plasmid miniprep kit (Zymo Research), and the plasmid was validated by sequencing (Macrogen, Seoul, South Korea) with sequencing primers (Table S9). .. Plasmid pTYGSade::FAS1::FASs2 was subsequently isolated from a sequence confirmed clone by the |